Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST272
Clone ID KST272
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST272
Sequence
GCANGTCATGGCGCAGCTTTGTGAGCTGCGCCGGGGCCGGGCGCTCCTCGCCTTGGTANTTCGCTGCTCCTCTCCGGGGC
CCAGGTGGCCAGCCGAGAACTAGACGTCCACG
Sequence Type mRNA
Unitrap ID UNI10273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30066531..30066643 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074227 (Spint2) NM_001082548 serine protease inhibitor, Kunitz type 2 Gene [Source:MGI Symbol;Acc:MGI:1338031]

 
Come back to gene ENSMUSG00000074227


For any suggestions or comments, please send an email to unitrap@crg.es