Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E115D06
Clone ID E115D06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE115D06
Sequence
GACGCCCCGAGAACAAAAAGAGAGACACNNTGACTTCTGGCTAGTATGCTGTGCTATAAAGTAGATACAAGCTCTGAGTA
GACACTCCATTTACAAATATCACTGAGAAATTTGCCGGGCATGTCAAAGAGCCTTCATAAAAAACTTCCAAATCGAGAAG
CCATAATACAGGGTCAGTGCAAGACAAGAATTCTCAGTCAGTTATCATGCCAAAGGGCTGAATTAGGTTCTCTAAAACCA
GTACGCAAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE115D06
Sequence
AGTCCTTAGTCCAATTTCCTGAGGCCACTTGCTATGGTGGTCCTGATGGAATTTAGTTTCTTCTTGGAAAGCCCAAGAGA
ATCTCCAAGTGTTGTAACTGGGTGGAACTGTGTCTGTCTTGCCACCCTTTATTGCTTTCTTGTTCAATAAAGAGTTTTAG
AAGACCAAAAGGACAAATCTATCAGTTAGAAAGCAGCAGTGACAGAGTGGAGAGCTGACCTTCTCATCCTTTTTTTTTTC
C
Sequence Type genomic DNA
Unitrap ID UNI23118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110015840..110016080 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es