Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E115D01
Clone ID E115D01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE115D01
Sequence
GGATCTGAAGGGTCCTTTTAGCAGTGCCTTCTTATCTTATAGACAGGGCATTAGGCCTAGGAAGTTAAATGAGGTAGCCA
AAGACAGGTAGGTGCATAATAACAGACTACCCACTGTTTGCACCAGAATCCCTTTTGTTTGCTGGTTAGCTCTTCGTTTT
ATTTACTTCAAAAGTTTTTAAACATATACAAAATTGAGTGTTTTAATTTGAGTACCCCCTCTCCCCTGCCTACTGTGTAT
CTGATTTTAGGCAAGTGAGACTAGCCACAACAGAAGGTTTTGTTTTAATTCTTTTTGTCTTAGGATAGGAATTACAGGTA
GTATGTATTTTTTTTTTCTTGGAAATGTAGATGTTTGAAGGTCCTAAAGTATTTTTCACTGGACATCTGTATAGTTAGTA
GTTTGTGAGACCTTTTATAGCAGCAGTGTTGCACATGAATGAAGAACTATCAGCCTAAGCTTTCTGATAATCTAGCTTAT
CTATTATTATTAATCAGTTATTTTGAAAAAGGGCAA
Sequence Type genomic DNA
Unitrap ID UNI11046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32868993..32869508 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es