Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E115A06
Clone ID E115A06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE115A06
Sequence
TTCAGGGATCATTTATTTCCATAATTCATTACCCTTTAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54053682..54053725 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es