Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E115A05
Clone ID E115A05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE115A05
Sequence
TGGGTCCACTAGTCACTAGCTATATATACAGAATGGGTTCTCTGGATAAAAGACAAGACAAAATGAGGTAGCACCTCTCA
CCATGTTACACAGAACAGCACCTAAGTGACAATATGAGTTATATCTAAAATTACGTATTTTTATAGTTTATCAAGAGCAA
CCAAACCTCCAGCTACGCATTCTGTTCTGGTAGTAAAACTGTTTACAGTTCATTTCTACTGAGCTGCATGTATACTTAGC
ATAGTTCAATTATAAGCTGCTTGATTTGGGGGACATTTTGTAATTAAAGGTTTTCGCTGATTTAGGTGTTTTTCATTCCT
TGGCAGAGCTGTGGAGCTAAACCATTTTCTCCTCCTATCAGGGCGAAGTCTGGACTACAGGAGAAGTGTGCAGCAGCTGG
GTCCGGTGTGTGAGGCCATCCACCTACACATCTCAGCTCTGACCAGGGCTCAGTTTGAAATTCAGTATTCGCCTTGGTAC
CAGTGGACAACTTATCCAGAGGTTTGACATTTGCATCTCTCTCGAAATCAAAGACTTCACAGATTGGAAGTCCTTGTTAC
TTGCCAAGTTAAGGATGTCTTTTTCATCTTTGGCCTAATGACAC
Sequence Type genomic DNA
Unitrap ID UNI16831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116861..15117464 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]


SPLK-Sequence tag 3SE115A05
Sequence
AGCAAGCAGGTAGATACACGTAGGTTACTTTAACAGAAGTTATATTTTATTGTGCCAAGGGTCATCACATAGTATTCATT
CTCTAAATTCCTAACTCCAGCCCTAAGCCTATCTCCCTAACTATGTGACATATCTTAACCGAAGCTCAGGTCCCCTCTTT
AACAGAAGTCTCTGATTTGAGGGTCAGGATTCTAGGGAGACTTTCCAGCTGCAGGGCAGAGCACAGTGACATCTCTCCAG
ATGTGCAGAGCAGAGCACGGCTTTTAGTCTCTGTTTATATACTGTCCAGTGGTCGTCATGGGGTTCTAGGCCTGTGTCTC
ATTATCTTGAGTAGGTGATGTCACTGAGTTCTGGTTACCAGGTGCAGCTTTGGGTGGAGTGGGG
Sequence Type genomic DNA
Unitrap ID UNI16831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15117466..15117848 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es