Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E115A04
Clone ID E115A04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE115A04
Sequence
TGATGATGACATTGTATAGACGTTCAGGAGCTTTAAGAATAGGAGGTGAAGCCACACACTTAACTCTGCTCTAATAAGAT
TACTGTAATCTGTATGTTGTATTTAGGCCTTGTGGTTCCAGTGATGATTGTATTTTAGGTATGGTTGCAGGTGGGAGAAT
TAAGAGAAGTCTGTTTTAAACTAGCTGGGGCCTAGAGACTTTGCTAAAGTAGCAGTGGCTTCTTTAGGTTACACAGAGTT
TCCATTCTTCGTGAGAAGTAACATCCTTTTGTTGATCTTTGGACCTTCGGATAGTGTACCTCATTTTCCAAGTGGTTCTA
GCTGTCTCTCTGGGTGATGAGTGTGCGTGGCTTGAACATTTTTTTGGATGTAGTTGATGTCCAAAAGCTAGTTTTATGAT
TACCATATAGATGGAGTGTAATTCTAGAAATAGGTCTGTGAAAAACTTTATACCCCACAGTTAAGCCAGGTTGTAATGTA
AACAGGACTCGGAAAAAAAGCAAGAACAGTTTTGTTTGTAATTTGTTTCTAGGCTAAGAGAGTGGAAATCTNNNATTAGG
TTTGACTTCAAAACTCAGCTGTACCCCTGACTAGTTNNNAGATTTTAAACTTGGTGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI22568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 85377721..85378340 591
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035529 (Prdm4) NM_181650 PR domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1920093]

 
Come back to gene ENSMUSG00000035529


For any suggestions or comments, please send an email to unitrap@crg.es