Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E114G05
Clone ID E114G05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE114G05
Sequence
ATCTCTGTCCCTTTTCTAAAGGTGCTCACCATAGATTGGTTTTCTCTATCCTGCAGTTAATTGGAATCTGCTGTAGCATA
TGTAGTGTTTTATAACCCGTGA
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22755633..22755734 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


SPLK-Sequence tag 3SE114G05
Sequence
AATTCCCACTTGTTTTCCTCTGACCTCTGCTTTTGTTTCATGACTGGTGCTCACAAGCATGTGCTCATACATGCACATTT
AATAAAACACCAGTACCTGAGATGCTGATAGCTAAAGGAATTGTATTTTTGGTTTAAATAATCTACGTCATTATAAAAAA
GCTAATAAGTCTTGTTTTGAATCAGTCTTTTCTTGTTGTTGTTTTTTGTC
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22755224..22755433 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es