Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E114D02
Clone ID E114D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE114D02
Sequence
ATTTACATTTTAATGTTATCGTTCTGACTTCTTGCTAGAGCAAAAACTGAAGAGAAGAAATTGCAGAGGTAGGTAATTTA
GAGTAGAGAGGTTTAGAATAATGGTCAGATTTGAGATGCATTTTGGTAGGTAGGATAGACAGAGCAAGCTAGCAGAAGTG
TGCAAGTGAGGTAGAATNNNGAGG
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4605483..4605666 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es