Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E114C01
Clone ID E114C01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE114C01
Sequence
CTTAATGGAGGACTGAATATATTGTAGCAGAGTAAACAGGATAATGTTTCTAGAGGCAACTGCACTGCTGGGGTGCTTGA
GAAAGTGTAGAGTGCCCTCTAATGAGTAGGTGGCCTGAAGTCATCTCTAGTCTGGCCTTGAATCCCGTCCTGGGTAAGGA
GTCATTCTTTTCCTAATTGCACTATGGAGTCACT
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4605257..4605450 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]


SPLK-Sequence tag 3SE114C01
Sequence
CTGTAAATTGTGTGTTTATAGATTTGGTTTTGGTTATTTTAAATTATGCATATGTATGGGAGGTTAGGGGGTGACA
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4606025..4606100 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es