Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E114B06
Clone ID E114B06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE114B06
Sequence
ATCTTCCAAAATTTGTTTCTGAGGGCAGTTGACATGCTAAGGCTAATAACACCAGACCCATGAATACTTCCACAGCCATG
TTGGGTTTGCTCTGCTGTGGGCCAGTACCTCAATGAGATAGACTCCAGGAGAGTCAATGTCTTCTGCTTGGACTTCATGC
ATGACCCTGGGGCTCAATAATGAAAGATAATAATTTTATGATTGTTATACTTATAGGTATTAGATATAAACCATTAAAAT
TGTTATTTCTTTATGTGAGAGAAAATCACATTTGGGCCGAGAAATTTGATTTGAGTTTTATGATATTGGCAGAAGAATTT
CCTCAGAATTCAGACCCCATTGCTTTTCTGCAAATAGGAGCTAATGG
Sequence Type genomic DNA
Unitrap ID UNI25742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76320865..76321230 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es