Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E112E08
Clone ID E112E08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE112E08
Sequence
TGACCATGACGACCATGACGGCTGCTGCTAGGGAGGGAGCCGCAGCGGAGAGCAAGGAGAAGTGCCAAAGGACAGCAGCT
GTCAGGATGAAATTCNNNTTTCTCAGCTGGAAACGTTTGTGTCACTGGCTGAATGTCCTGGGTGACTGCAGTGAGCATAG
CCTGCTGGAGTTTCTAGTTGTTCCGGTTCTGTTCCCCACATCAAATAAGAGTTGCGGGCCAGGGGCCCTGGAAGACGCTT
TAGCAACAGGCTGCTGTCTTCTGCCCGACAAGGAAGGGCGTGGCTTTTACTTTTCCATTCCTGCACAGATGGTGCAGTTA
TTTTCAGTTAAGTTATGTTCTACAGAGAAACATGCAACTCCTTTGGATTCTTTGACTTAGTGAAAAAGAGAGAGGAGAGG
AGGAGGAAGCCAACTTTGTGCTAAGGCTGGTCATGTTTTTATTTAAGTATATTCCGAGACACCGAACTGGGAGAAATATT
GCTGCCATTAGAATGCCCAGCTGTTGGGTTGAAAGATTTCTAACCTTTCAAGTGNNCAGGATAGCGATCTACCTGTTCAC
GATTAGGTTCTCTGTATTCCTTAGTTTAACTATGTATGCACAGTCCCACACAAGTGCTAGAGAAATGGGGTAAGGGTGAT
GGGGTGGTTCAGGGATGGAGGTTAAGGTAC
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101958877..101959546 636
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es