Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E112E02
Clone ID E112E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE112E02
Sequence
GGGGGGTTTGAAAACAGCCCCAAAGGTCTCAAAAAAAAATTTTTTTTAAAAAAAATAAAATGGTTTTTAAAAAAATTTTT
TTTAAATTTTAAACCCCATTTTTGGACAAATTTTTTTTCCCCCCCCCAAAACAAAAAAAATTTTTTTTGTTTCCGGGGGG
GCAGAAATCCATCCATCTAAATTTTTTTAAAAAATTTTTTTTTTTTTTTGGTTTTTTGAGACAGGGTTTCTCTGTATATC
TCTGGCTGTCCTGGAACTCACCAGACTGGCCAGAAATCCGCCTGCTTCTGCTGGGATCAAAGGCGTGTGCCACCACACCC
GGCTGACAGATTTTTGAAATATAATCAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE112E02
Sequence
AAGCTAGGGTGAATTAGAGTTCACTCAAATGTGTTCCTTTACAGATAAATGGCTTATCTCCAGTTGACTTACCCATTGTT
GTTTTCAAAGCCACACCTTTGGGTGTTGTTCATTTAGGGGTTGAGTTGAAGTGAGAATCTTGTGGG
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34922211..34922356 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es