Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST314
Clone ID KST314
Vector pGT1TMpfs
Project baygenomics

Sequence tag KST314
Sequence
TACTGGGCTGCGCAGGCCGGGCGCCATGCGGANGGGGCGAGCGCAGAGTCGCCGGAGGCTCGGGATCTGAGTCTCCGCTG
CTCAAGGGCCGCCGCAGCACCGAGTCTGAAGTCTACGACGATGGCACTAACACCTTCTTTTGGCGTGCCCCACACTTTAA
CTGTGCCTGNNTCATCCTNACCTGTGCTNNNNNNTTNNNGANCTCTNCTAGAT
Sequence Type mRNA
Unitrap ID UNI10284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148317276..148321249 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es