Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E111H05
Clone ID E111H05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE111H05
Sequence
TCACATGTGTCTACTATTCCTTCGCCAATAAGCAGCCCACTTCCAGNNAATGGCTCCTTTCTTGTTTATTAGTCACTTAC
AAGCCCTCCAAGTTAGATTCAGAGATC
Sequence Type genomic DNA
Unitrap ID UNI29704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24994052..24994158 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es