Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E110D07
Clone ID E110D07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE110D07
Sequence
GATCCTTGGCTAGGGAGGAGTAGGACTTTCCAGCGATTCCTAAGGTCCCCGCAACTTGAGAGTTTTAACGTGCTAGAAAC
GATCAGACTCCACTTCTCCTTGTCCTCAGCTCCCTCACATGGGCCACACCCCCGCCTCCAGAAAGTACTAGTCCTGTTTT
CTAGGCAACTCTCCGAAAGGACTTGAAAGACTCTTGGTTGAGAGCCTAGATTTGTTCTGAGCTAGCCTCACCCTGCCTCC
TAGAAAACTTGGGTTTTCTTTGAACCTCAGAGTACTGCCTC
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28116500..28116780 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es