Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E109B05
Clone ID E109B05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE109B05
Sequence
GATCTCTTTTGACTGTTGTTTTGCCTCAGAGTTTTGGAAACTAAGTAGTACCCCTCTATATGATAATCCTCCCCTAGCTG
CTTGATGCTGTTGGCTTGGTCTCCAGAGAGTTAAGTGCTCTCCCTGGCTGTCACTCATGTTTTATATCTGAGTAACGCCA
CATCCTGGGCAGGAGGGAGGGACTACCAAAATTGGTTTTACAGTGGTCACTTGCTAATGAGATGTAGAATCTTCTGGAAA
CAGTGAAAGAACAAAACTGGAACTAAGGGCAGAACTAGCTGTAACATACCCAACACCCACCAGTGACTGGAAGCTGAGAA
CCCTGGAACTGCTTGCTTCGGCAGTGGTCCAGGTACCTTCCATCTGTGAACCATCTCAAGAGTGCGTCGTCCCTTTTCTC
AGTC
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20578929..20579332 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es