Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E105A11
Clone ID E105A11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE105A11
Sequence
GCCCTGGGTGAAGCAGATGGGGCCTGTGTATNNNGAGATGGAAAGAAGGAAAATGGAGAGCTATTCACACAGGGCCCGAG
AAAACCTGCGATTCGCAATCCAGGTCTACAACCAGAGCGACAAGGGTGAGTGACCCCTTCACATCTCCACAGACCAATCT
AAGTCGCCCAGGGTCCCAAACCCTAGGTTTGGCCAGAGGGTGGGGAATTTGCAGAGTCCGGGAACCCAAGAGAATAGTGG
AGGGAGGGCTGGTTTCCAGTGTAGGTGAAAATTCCATGGGTGGGCGGGGCTGACTTTGAGGGACTGTCTGAGCCTCTCAC
CCTGAGATGGGGGTAAGGAGAAGTTTGAGCACAGAGCCTTTGTGGCAGCCTCTCACACCTTCCAATGTTTAATCTGTTGC
AACATGGGGCCAGACCGACGCCTCCTCCGTGGGCACCATAGACATGCTTCTGATGGCAGCTATTACATCATTCTGAACTT
GGACCGGAAAACATGGACTGAGGCAGACAGTACGGCTCAGATCACCCAGCGACAGTGGAAGGCAGAAGGTGTAGCAGAGG
CCTTCAGCCACTTCTTGAAAGTCTTCTTGTGTTCAGTGGCTACTGAGGCACTTGGAGATAGGGAAGGAGACTCTACAGCG
CTCAGGTATCAGGGCCTGAAAAGTAACTCCTCTATCTGCACTCAGAGGAGGGAGCATACTTCCATGGGGCAAGGAAAATG
GGAACAGCTGAAATACTACCACTCTTTTGCTTCCAGAGTTGGAAGAGAACTCCTGGTTTTCCTGACCCAGCANCAGAGAG
TAGCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI11918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107102..37107910 795
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  


SPLK-Sequence tag 3SE105A11
Sequence
GTCCCAGGGCTCACNNATTCTTTCAGGACAGTTCAGAGTCTCTCAAGAGAATAAGATAGAAGATTCCTGAAATAACCAAT
AGCCACTTCCTTCAACCTCCAGCCCGTTGTGAACTATGGCCTCCCTTATGCTAGGTTCTCTGCTCACACCCAATATTTTT
GGAGGTCCCACTAGTGTCGACACCAGTCTNTNTCCGCTACAATGGAAGACGCTCTTGGCATGGAGGATGACTTGGGAGTG
TTCTACTTCGGATTGCCTAACTATGAAAGAATAATTTTCACAGGAGCGAAGGATACTGATGCCTGGGGGTGAACTACTTG
TGTGGTGCTGGCCTCGCTTCTCCTCTGGACTCTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es