Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0160
Clone ID BB0160
Vector pGT2lxr
Project sanger

Sequence tag BB0160
Sequence
TTTTTCTCTCTTAATCATTTGCCTCGATTTCACAGGGATCGGTAACCTAGAGAGCAAGGCTAAAGACGCACTAGTAGACA
TCATTGGAATCTGCAAGAGCTATGAAGATTCGATTAAAATCACAGTGAAGTCGAACAACAGAGAAGTTGCTAAGAGAAAC
ATCTATTTGATGGACATGTCAGGGAAGGTGGTGACCACAACTCTGTGGGGAGAAGATGCTGACAAGTTGGACGGCTCTCG
GCAGCCCGTGATGGCCATCAAAGGAGCCCGAGTCTCGGACTTCGGTGGACGGAGCCTCTCGGTCCTCTCATCCAGCACTG
TCATTGTGAATCCTGACATCCCAGAGGCCTATAAGCTTCGTGGCTG
Sequence Type mRNA
Unitrap ID UNI1158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75125802..75126531 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es