Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E098C10
Clone ID E098C10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE098C10
Sequence
GATCCACTCCCTAGTTTAGACTTAGAAAGGATCAAGGCTGAGTGCCAAACTGAATGAGAGCAAGTCTCCAATTCTGAACC
AAGGCTTAGTTGGCTGCGAGTGCTAAACGCACAGGC
Sequence Type genomic DNA
Unitrap ID UNI23144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135219871..135219986 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


SPLK-Sequence tag 3SE098C10
Sequence
CGCTGCTTAGACACACGCAGCAGAGAACTCGGCTGGTGCCCGGTTGCCTCTACTGCCCTGATTGGCCCTCCCTACCCTTA
GATGTCAACACGATCTAGCTCCAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es