Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E098A02
Clone ID E098A02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE098A02
Sequence
ATTGAGCTGGAATCTTTTCAAAATTAATTGCGTATTTA
Sequence Type genomic DNA
Unitrap ID UNI29714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8603773..8603810 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058159 (T2) NM_013682 brachyury 2 Gene [Source:MGI Symbol;Acc:MGI:104658]

 
Come back to gene ENSMUSG00000058159


For any suggestions or comments, please send an email to unitrap@crg.es