Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E093H06
Clone ID E093H06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE093H06
Sequence
GAAACAAATAATTCTGAATTTCAAAACAGAAACATATGAATAGTTAAAAGTCACTGGAATTTTTGAATGGAATCATATTT
TCTGAAGGTACAATTCTATTTCATTTCAAGGACATCTGTGCCATTGAAGAGATTAGGATATGAATATGTCTAGAGAGTGA
ATGGAAATTTTGTTAATTGTAAATCTTCGTTCATATCTAGAGAAATAACTGTTATGTCCAAGTCACAGGGACCCCAAAGA
CCACTGAGGAGCCAATTCTGATGTAAACACATGAGGGTCTTTATTATGAGCTCATGATCAAGGTCTCTCACTGTCCCTGT
TGCAGCAGGTCAGAGTGAGAGCCCTGAGTCTAGGGGTGTAGCGTGTGTATTGTAGTTACTGCAAGCTTGGGGAATTTCTA
TATGGGTCAGCAAGTTAATATTTTAAAAACTGCATTTCTGGTGTAATCTGCAGGAACCGAACTCAGGGGCAAAATCACCT
GACAAACAGGATGGCCAAGTTATCTATCCTCTGCAGGATGTCTTCGGTTATCTATAT
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82318613..82319149 531
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


SPLK-Sequence tag 3SE093H06
Sequence
ATATGTACCTTGACCCTGCTATTGTAACTTGACTGGCTGTTTGGGGGTGGGGGAGGGGCTTGCTGTGGAATGTTTGCTGA
AGTAGACGTTTTGGTTTTCTTCTTGTAATTGGAGTTTAGCCCCTGCTTTCTCACAAGATGTAGTTTCTTCAAAAAAGGGG
TTGATTGGGCTTTACAATAACTTGTATACTTAAATTTTAAATACTTGTTTTAAATGTGGGGGAAATCAGACTTGGGAATA
TCCCATTCAAAAAAATGTTGTCTAAAGACTTGAGTTGCAGCTTAGTGGTGAGAGTGCTGGCCTAGTGTAAGCGAG
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82319146..82319460 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es