Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E092C02
Clone ID E092C02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE092C02
Sequence
TTCTAAACATTTTCCACGGGTAATTTACATGTTTACTTAGTTTTAACATGCCCCTCCCCTGGCAGGGTGAAACTGAAAGT
ATGGACTCCACNNNTGCNNNNNTTTACCACTGAGNGNTCAGCCTTTAGAATGGAGCCTGCATGCACTGCTGCTTTTTACA
GATGCGTTCAGCGAACTCGTTGCTCCGATATTGCTGGGCTCTACATTACCACGGTTTACAATTGTCCAGTGTTTTCCTAA
AGCTGATTTTGTTTTTGTTTTCTGAGGTAGGGTCCCAGGGGCTAGGATTTACATGAATGCCCCCATACTTGTTCTTTCCA
AAGCTCTTGGTGCTAACACCAAGGAATTGTCACTTTTTAGCATATGGATGAGGCAGTTGAGACACTAGAGTATAATGACC
ATGCCAGGGTCTGGCAGTACCTACCTGAACACGTTCCCAGCCCCAGACTATTTGCAAAGATCCA
Sequence Type genomic DNA
Unitrap ID UNI29721

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87167567..87168029 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024140 (Epas1) NM_010137 endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]

 
Come back to gene ENSMUSG00000024140


For any suggestions or comments, please send an email to unitrap@crg.es