Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E091F12
Clone ID E091F12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE091F12
Sequence
TCGTTTTAGAGTTTCATGTGTAAACCTTACAGGACTTCAGCTTCCTCGAATACTGGGATTTAGCCAGGA
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43200508..43200576 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es