Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E091F02
Clone ID E091F02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE091F02
Sequence
TGGGGGTGGGAGGGAGGATTTTGCTGGTTTGTACTGGTTGGTTTTGAACTTGATACATGCTCCTGGCTGGTTCAGAACTA
GGCTCTTAGACATGCCACTGCGCTCAGTTTTTAGTATGCCTTTTGAAGCAGTAGTTCCCCAAAAGTCAGTATTAGACAGG
TTTTCAGCAAGAAT
Sequence Type genomic DNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74700405..74700577 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]


SPLK-Sequence tag 3SE091F02
Sequence
CTTCCCACAAAGCAAATGTAAAAAAAGATTGGAAAAATTGAAAGGACATTTTAAAAAGAAGCAGTTGTCTAAATGCCTCT
GACCAGTTGCCATGAGTGCATCTGTGTGCTAATGTTGCTGGTGGCATGTCCTTTCTTTACTTGTTCTTTTGCTGGAGGAC
AGTACTTAGGAAACTATACACACTGTAGGCATATAGCTTGATGAGGTTTTTTTGTT
Sequence Type genomic DNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74699951..74700166 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es