Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E091A08
Clone ID E091A08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE091A08
Sequence
AATGTTATTAAAGGCCAAGAGCTTGTTCCCCAAGTTGCTCGAGTAGCCTTGTATAGTCCTCGAATATTAAAGCAGTAAGT
TGTGTGAGTGTGCAGTGGAAATGACTAGTATTCAGGTTACATACACCTAAGCAGTAATTCAGACTCCCAAGTACATTAAA
CTGGTAAATGCCTTCTTTGTTATGTTTTAATATGTTGCCTAAGAGACTCGTTAAAGAACCATTTAGAGTTGAACGTTCAG
TTGAAACGTTAAGGCATGTGTTGTCTTAAGACTAAGTGAAAT
Sequence Type genomic DNA
Unitrap ID UNI428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10933729..10934010 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049969 (Plekhf2) NM_175175 pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI (curated);Acc:Plekhf2-001]


SPLK-Sequence tag 3SE091A08
Sequence
CCCATTGTNNGGACGCGTTCGACTTACTCCTATGGGGGTGTCTTTCTCTTTTAACACAATGGTTCAAGAGAGTATTGTTA
CGGAATTGGAATTAATTTGCTTGGGTTAGACAGCTCATTTATGTCCCCCCTGCCCCCACTTGTAACTGGGGTTCAGCTTG
AAGTATTCCAGACTTTTCAGCCGGGGAAAAGAGTTACGCCTGATTTAAAATTATGTTATGTGAGTCGCAAAGACTCTTGA
TTACGTATGCGCCGTGTCCAGTCATGGTGGATGTCCTTGTTTACGCCTTGCTTTCTTTCAAAGCATTCATCTTTTTCGGT
TGCGATGATTTATCCCGCTCCAGACCACACCCGTATAGTTCAGAAGAAATTTTTCCTGATTTTCTTCTCTTCACCATGTG
ATTATGGGGATGGAATTTAGGTTGTCATGCTTGGGGGCCAGCTGCTATCATTACTTTCTGAGCCACTTTTCTGACCCCTC
TATTTATAATTATATCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACACATTTGTGTGCGCGCACGTCGCA
CGTGTGTGGGTGGCAGGGATATCTCTGTGGATTTTGTCTCTCCACCCCCTCTCCCCCCCGAGAGAGATGTGAGTGTGTCC
TCGTGTGTAGACCCTCTCTCTTTCCACACACAGNNGNNNGNGTNTNNNGNNNCNGNNGGGGGGGGGGGGGGGGGGNNNNG
GCCCCNNNNNNNNGGGGGCGCCGCGCCCTCGNGTGGTGCCCCNNNNGNGTNNNNCCCCCCCCCCGGTCCCNNTNCNCCTC
NTTTNNTTNNTNNNNTTTTTNNNTTTCCGNGCCCTNCCTTCNNGGCGCTTGGGGCTTTTTTTTCCCCCCCCCCCCCCCCT
TTTCNCTTTTTTCTTTTTNNNNTNNNNNGGGGGGCCCNNNNNNNCCCCNNNNTTNCCTCTCCCCGGNNNNTTNGNGNGCC
CTCCCCCCCCCCCCCCCCCNNNNNNNNNNNTNTTTTTTTNNNNNNNNGNNGGGGNNCCCCCCCCCCCCCGCGCCCGCCCN
NNNTNTTTTTTTTTTNNCNCCCCCCCCCCTCNNNNNNCNNGCCCCCCCCCCCCTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000049969


For any suggestions or comments, please send an email to unitrap@crg.es