Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E090C09
Clone ID E090C09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE090C09
Sequence
GTACATTTTTCAGGGCTATCAGTTTTCACTTAGTGAATAGGAGTTCCTGTTTCACTCAAGCCTCAGCCAAGACTGTAACT
AAATAATGTGTGGTGTTTGTGTCCTGTGCGGACAGCCGGACTGCTTTATGACAAGAGCAGGTGCCTTCCTGTTTGCCTGG
CACTTCAGTCCAGCAGTAAAGACAGGCATTGACTGCGCGGCTTGG
Sequence Type genomic DNA
Unitrap ID UNI29730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44126597..44126801 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052459 (Atp6v1a) NM_007508 ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI (curated);Acc:Atp6v1a-001]

 
Come back to gene ENSMUSG00000052459


For any suggestions or comments, please send an email to unitrap@crg.es