Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E089E06
Clone ID E089E06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE089E06
Sequence
GACCTTTGCGTTAGCATTATTTCTGACTAATGGCTTTGTAAAACCGAAGAAACCGATCTTTGTTGGGGGTTGGAGGCAAG
AAAGAAAGAAAAGTGTGAAATACAGGGCAAAGGAGGGGCTCCTCTAGGCTTTGTCAGGGACCCTAGGAAACAAATGACTT
TTTCCTCTTCCCCAAGGGTTGGCACATGAACTCAGGGTAGAAATAGAAGTGGGCCTTTCTCCCTTTGTGTGCACACATGT
TTGCGTTTAGAAACAAGCCTGTAGGTTGAAAGCTGCCCTTACCTTGGCAGGTAGTAGAGAACCTGGCCACTCCATGTGTG
GCCTTGAGAATACGTC
Sequence Type genomic DNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954277..62954612 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]


SPLK-Sequence tag 3SE089E06
Sequence
CGTCTGCTCAGCTTCTTGGAAGATTGCTCATCATTTCCTGCAGGCCATTTCTGGGTTGTCCAGCATGGCTCACATTTAAC
ATTTTCCACACGAGTGAACCTGGCTTTGTCTTTATACAGCGTTTCTTGGTGGGGCCCCGCTGACCTTTCTCAGATGGCTG
TAGG
Sequence Type genomic DNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954609..62954772 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es