Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E088E08
Clone ID E088E08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE088E08
Sequence
TTTGTTCTTTATTTAAAGATGGAAACATGGCGGCTGTGTCATCTCTTGAGCTCAGACTAGTCAGAGTAGGCAGCCTGCTG
CTGTTGATTAAAAGTGTTT
Sequence Type genomic DNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72513241..72513339 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es