Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E088D12
Clone ID E088D12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE088D12
Sequence
GATCTTCATTTTACCAACCAGAGGGATGAGTGCATGTGGTGGGGACATGGGCCTTCAGGACCCATATTGGCTTCTTTGCC
TAGAGAGAGGTCTTCAAGGGCTCTTATCTGAGTAGGTT
Sequence Type genomic DNA
Unitrap ID UNI29740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181326150..181326267 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]


SPLK-Sequence tag 3SE088D12
Sequence
CAGGACTCTGAGGAGAAGCTATCCCTGAGGTGTGGTGCTTTGGGTGCCTGTGAGCCAGCAACCATTACTAGTGTTAATTG
TCCCCTATGAGGAATATTATCAGTCTTCTTCAATTGCGTGGACCCTCTGAAGACAGGCTGATCCTCAGCAGCCTTTGGTC
TTTGTGTGTCTAGATGAGGGAGTAGGTGAGGGTGTCAAATGTAGTAAGAGTCTTGGCTCTTTCTACACTTCTCATGTCTT
CTGGGTTATTTAGAAAGACCTTGTCTGGGCAAACCCCCTTCTCTAAGTTAGAAGCTTCCATTACTTGCTTTTTGATGTGA
TCAATATAGGAGGTCAGGGCTAGAGAGACATATTGAGGGCCTCTAGGATAGCCCCAGTGAAAGTCCTGGGTTGAGCCTGT
TCGTCTCATAGGTCTGTGTACTTACTCTGCAGAGATGACTGAATCCTTTTGTGTTGGAGGAGGCCGTCGGCTTCAAGG
Sequence Type genomic DNA
Unitrap ID UNI29740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325645..181326122 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]

 
Come back to gene ENSMUSG00000000823


For any suggestions or comments, please send an email to unitrap@crg.es