Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E088D01
Clone ID E088D01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE088D01
Sequence
GTTTGTGAAAGTGCTAGGCACCCAGTAGCATCATCTTACTGAATTTTCCACTTAGCAGCAACGTCTTCTGGAAGACACCT
GAATCTCCCTCTGTTCTGGGATCC
Sequence Type genomic DNA
Unitrap ID UNI428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10930752..10930855 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049969 (Plekhf2) NM_175175 pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI (curated);Acc:Plekhf2-001]

 
Come back to gene ENSMUSG00000049969


For any suggestions or comments, please send an email to unitrap@crg.es