Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E088A02
Clone ID E088A02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE088A02
Sequence
TGATATCAAAGAATGTGTGGGAAGAAGATGGCGGCCTGACAGGGGTGTCACTGCTTGTAATCTTAATGTTGGGGAAGCGG
AGACGAG
Sequence Type genomic DNA
Unitrap ID UNI29742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5600070..5600156 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es