Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E087G01
Clone ID E087G01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE087G01
Sequence
ATTTCCTGGGCCGGGCCGCTTCTTTTGAGGTGGGGAGAGACAAAGGTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE087G01
Sequence
ACTATGTCTTGCCCTGTTCAGCACTTTTAAAGTATAGGTGTGGAAAGAAACTTGTGTTTGTGTACGTATCAAGTGATAGG
AGTCACACAAAAACTAATACTGCTTGCCTGTGTTTGTGGGACTGTTCAGTGGGAAATACTTGGCTTGTTATGTGAAAGGT
TAGGCACTGTTCCTAACAGAAAACAGGTGGGGTCGAATTAGCCCTGAAGGGTCTGACGCTTACAAGAGTGAGCTGGCTGC
ATTTAAAATGCATGCTTTTCTCTGAAGTCCTGTCAGAATGGCCTGAGCCACACGTGCCCAGTTAAGGGGGAGCAGGAATT
TCATATTCTACCTGAGTTGCATTTCCTAGTGTGAAAGCCAAACAGGATGAGCCTGAGGAGGCCACTTCTACCTGCCTTGT
CAGCTTCTAGTCTCTGAGGAAAATGAGGCTGTTCCTGTCCAGGTTTTAGTTTTGAGGTTAGTCCCAGTGCAGGTGACTGC
ACACACTCCGTGCGCACTGTTGCCTTGTACCCACGTGCATGCCCTTCAGGCTAG
Sequence Type genomic DNA
Unitrap ID UNI23572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20143408..20143941 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es