Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E087E06
Clone ID E087E06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE087E06
Sequence
GATCTAATCTAAGAGACTCATACATGATAGGCAGACACCAGTTTACTGCCCAACACAGACCTAAAGTGGCTTTCAACCCT
ATGGTTTAGTTCTAGGTT
Sequence Type genomic DNA
Unitrap ID UNI1344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30075252..30075349 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es