Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E087A03
Clone ID E087A03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE087A03
Sequence
CTCCTTGGAGTATGGCTTTACTTTTTACCACCTTAGTGGTGGCAGATAATACAGGTCCTTTCTTTCTCCCAGGAATATGT
TAGCCTTTAAAGTCTTACAGCTAGCCCTAGTATTTCATTGTGTAATCTAAA
Sequence Type genomic DNA
Unitrap ID UNI29744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155749207..155749337 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026473 (Glul) NM_008131 glutamate-ammonia ligase (glutamine synthetase) Gene [Source:MGI (curated);Acc:Glul-001]

 
Come back to gene ENSMUSG00000026473


For any suggestions or comments, please send an email to unitrap@crg.es