Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E086E06
Clone ID E086E06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE086E06
Sequence
GATCCCCCGGCCGCAGCGCACCCCCCAGGCCCACGCTTTTCGGGGTGTTCTGGAGATCGCCGGCCGGGGCCTTTGCTGTC
TTCTCCTTGGGGAAGGAACCTCCACAGTCTTTAGGTATAGACGAGGGGAAGACTTTGAGTTACTCCCTTCCAGTGTAGTG
TTGGGGGAAAGGGAGACATAATGGGAAGGGAACTGAAACAATTTCCAC
Sequence Type genomic DNA
Unitrap ID UNI13226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65929178..65929385 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]


SPLK-Sequence tag 3SE086E06
Sequence
GGTGGTAATCTCTGTTTAACGGACCCAGCCCGTCCCTAGGCCTCATCGTTGACATTGAGGGCTTTTAGTCAGGCCACAGG
CGAGGTGTCTGTTAATTAAATGACTTGAAGTAGGGAGAATAATGGAGTGTCTGAGTAGCCTATTTCAGAATACTGTTTAC
CAGTGTCAGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es