Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E086A04
Clone ID E086A04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE086A04
Sequence
TTAAAATACTTTATAACATTACATTTCTGCAATGAATATACAGTTTGAAGAAAATGCTACTGATGTGGTTGTCATGGGGC
ATTGTTTAGTTTGCCTAAGTTTTTCCTCTATTTTGATGAACATTTTACTTTACTTTTCTA
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62265136..62265275 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SE086A04
Sequence
TACATTTTATTTTAAAAAATGTTTTAAGCAGGGTCTTGCTGACCAGGCTGGCTTCAGTCCTTTTGCCCAAGCTCTCTTCC
TGTTGCAGTTGCCCCAGGCCCAGCTCATTTTACAATGAGAAGTCCATTTGTAGTCAGTTTGTTGGCTGTTGTTTCCCACC
CACCACACCTCACTGCTGGCAATCTGACGCCAGGCCTAGAGCGTACTACTAAGCTGTATCCTTAGCCCTGTAATAGTAAT
TTTCAAAATATACTCATGCCATAACATTTATTTTAAAGGGAAAGCTGTATTATTTATTCATTCAT
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62264324..62264628 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es