Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E085G11
Clone ID E085G11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE085G11
Sequence
AGCGTTTTCCGGAAGCAGCAGCCCTTTTTGAGGGGATGGGCGCAACCCGGCCAGATGGGCGAGAAGACCAAGAAAGGTGG
GCCCCGATTGCAGCTGGTGGAAGTGGACCCTAGGCCTAGTCAGTGCAAAAATAGGGGTCGGGGACTATGTGAACGGAGTT
GGAGAGCTCCTGGTTGTTAGGAAAACAAACTTAAATTTTCCAGAGTAGGACCGAGAGGGGAACATCCATCCCTCCCCCTG
GCCCTTTCACTCAGAATTGGGGGAACTCCGATAATGCCCCTGTTTTGTTTGCTGGAAACCTTGTTTGAAT
Sequence Type genomic DNA
Unitrap ID UNI29748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152157536..152157845 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027466 (Rbck1) NM_001083921 RanBP-type and C3HC4-type zinc finger containing 1 Gene [Source:MGI (curated);Acc:Rbck1-002]

 
Come back to gene ENSMUSG00000027466


For any suggestions or comments, please send an email to unitrap@crg.es