Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E085C03
Clone ID E085C03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE085C03
Sequence
AACTGGAACAGGAGCCCAAGACTGGTGGATGTGACGTGTGGGTGCGGGGCAGGGGGTGCGCAGGAAGGTGTTGAGGCTCG
CTCCCGGGAATGGGCCCGGGAGGGAGGAGCAGGCAGCGCTTTGAACTTGCGCTCAGCCTCCAGAAGAGGGCGGGGGAAGT
CCAGGGCCGGCCGGCTGCTTTCACCTGCGGATCCCACT
Sequence Type genomic DNA
Unitrap ID UNI29749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103656754..103656952 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000125 (Wnt3) NM_009521 wingless-related MMTV integration site 3 Gene [Source:MGI (curated);Acc:Wnt3-001]

 
Come back to gene ENSMUSG00000000125


For any suggestions or comments, please send an email to unitrap@crg.es