Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E084C09
Clone ID E084C09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE084C09
Sequence
GGATCCTTAGATTAAAATTCTCAAGACCCTCTGTCTGCTCGTCCTGCTGAGGTGTTTCTGAGCTGTCTCTTATGAATTAG
GTACCGGGGCATACACTACAAGAGTCCCTGAACAGCCTTTGTCAAGAAGCTTTCTGTACCACTCCACCCATCTTGGGAAG
AGAGTAGGTATGAAACCTACCCCACTGAGAGTGTCGCCACCAGGAAGGGAGTGTTGACTTTGAAGGTGGAGCCAGTCAGG
TTCAGCTCCCACCTCAGCAGATTTAACTAATCAGCAGATTTCCCGTAGTCACAGCCTGACCTATACCAAGCACCTGTCAA
TACTGCAAGGTGCCGTAAGGGTCTTTTCTGAATACCCCACAACCTGGTACTGTGGCTCAGGCCTATAGTCGCAAGGCTAA
GGTAAGATAGATAGAAGTGAATCTAAAGGCTGACATGAGCTGTTGAGTGAGTGTCCGTGAGAATTTGCCTTTAACATGAA
TGACT
Sequence Type genomic DNA
Unitrap ID UNI29750

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133058161..133058645 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026427 (Lgtn) NM_010709 ligatin Gene [Source:MGI (curated);Acc:Lgtn-005]

 
Come back to gene ENSMUSG00000026427


For any suggestions or comments, please send an email to unitrap@crg.es