Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E083B12
Clone ID E083B12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE083B12
Sequence
CTAGAAGAAGACGGGACTGCTTTAGTNTACAGGCTAAAGCTGAGATACGTCACTGAGAGATGAGTAGGCAGGACATCCCC
CCTAACCCTACCCCAGCAGGAACCGGAAGCAGAAACCGTGAAGGG
Sequence Type genomic DNA
Unitrap ID UNI24492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5397547..5397671 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es