Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E083B06
Clone ID E083B06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE083B06
Sequence
CTTCCAGGGGTCACATTTTCTTTGCGAGATTCCTGTGGATAAAGTGTGGTCCTTGCAAGGGCCGGTTTGTTTCATGCCAG
ACCTTGTATCCACAGCTATGGATAAATACTTGTATGAAAACTGTAAAAAAATGAATTTTTTCAAAAGGAAAGGAAAGTTT
TGGCTTGCCAGCAGGCTTTGAGCTTTCTGTGGAACTTAGCAAACCCATCGTTGAGGGAGGACTTTAACTGACTCTAGGGT
TTTCATTTTACTTTTGTTTTGAGG
Sequence Type genomic DNA
Unitrap ID UNI14694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30143084..30143346 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es