Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E082E08
Clone ID E082E08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE082E08
Sequence
TACTAGCGAGGAACGGNNGTTGTGCCATAGGTTCACTTCTGTAAGCATCATCTGTCTGTAATCTGGCATCCAAGTGGTCT
TTCCTACCTAGGAACAGAATATGTTAAAGTACTTATTTTGAATATGTTAGGAAGTAAAATATTTATATCACAGTGACTAG
TGAAAGTGTGCTAGATTTTCAGGATTGATTCTGATACCATTCACTGTCTCCTGTCTTGTGGTATAGCCAGACAGGGAGGC
CCGAGCATTGGCACATAGGATGCTATTCATAAGAGAGATGTCTCCTAGTTACTGCTGGCATTCAAGCAAGGTTGTTAACA
GGCAGTGCTTTCTTTTTGTATTTTTAATATTGGAATTCTATGTCTTTATTCTTTAATGTTGGGATTTTAAACAACTATTT
GTAGCTATTTCCCCAGGCATTAAGTATGAAGACAATTTATTTCAGAGAAAGGTGGTCAAGAGCTCTGCAGACACTGTCAG
CTGGACCAGTAGCGAAGGAGACTCTGCGGTCCCAGTGCCCCTTCCTGACTCCACCTCTGTACGCTGTGCTCAGTCCTCGG
CCTGGCTNNNAGCAGAAGCAGAAACTGGTACTGATTTTGTTTCCTGTCTAGATTACAGTTTTATTCAGGGGCAGGGCTCA
CTTAGACC
Sequence Type genomic DNA
Unitrap ID UNI29754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125402389..125403035 634
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068394 (Cep152) NM_001081091 centrosomal protein 152 Gene [Source:MGI (curated);Acc:Cep152-001]

 
Come back to gene ENSMUSG00000068394


For any suggestions or comments, please send an email to unitrap@crg.es