Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E082D12
Clone ID E082D12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE082D12
Sequence
ACCCTTCCCCGCCGATTGGAATAGAGGGAGCTGGCTAGCCTAAGTGTCTGGAGAAATAGGGGCTTTTTAAAAACCTTCCC
CTCTTGACCATACTGTTACTTCTTGGTGCTTTTAGTATGTTCTCTCTCCAAGCTGAAGCCAGAGGGAGAGAATGAAAAAT
AATTGGT
Sequence Type genomic DNA
Unitrap ID UNI13542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8671281..8671447 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es