Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E080G08
Clone ID E080G08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE080G08
Sequence
TAGCATTATGAATCTTGAATCATGAATGTTCTGAATACTGTTTGATATTAACAGAAACGCTGTGTTCCTTTGCTTCTCAG
GATAGAAAGACACATAGCATTTTCTGGTAGGTGATTATGATTTATGGGATGTATAATGTGTAGCCTTGTTGGAGATTAGG
CTCTTTCTGGTGTATGATCCTGGGTTTGGCCTGAAGGTCATATTTTTAAAGTATCTATACAGCTGAGATAAATTTTTCAC
TTATTCTGATTGCTGCTGAGTGCTACCTTGAGGCTTCTAATTAGAGACAATACACTAGCTAATAGGTAAGGCTCAAATTC
AGAGTCATACCTAGTCAGACTCTGTAAGCTCATACTGAAGTGACAGCAAGCCCACTTGTTTAGGTAAAATCAGTCCAGGT
GGGAATGCCATACTCCCCTGAGCATGATGAGAAAAGCTACACATTTCTAGGAAAAAGGCTAGGATGGGGTCATCATTCAA
CCTCTCACGCAGGAAGAGAAAGGAAGGGGATGTCTA
Sequence Type genomic DNA
Unitrap ID UNI14337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9630005..9630520 514
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]


SPLK-Sequence tag 3SE080G08
Sequence
CTAGATTTTTAATGTACATGGGTCTGATGAGGATAGGGTAATGCATAGGTAAAGCCCTTAAATGCATCTCTAGAGCTAAG
AAGGCAAGTGCTGTGCTGCAGTCAG
Sequence Type genomic DNA
Unitrap ID UNI14337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9630770..9630874 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es