Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone KST059
Clone ID KST059
Vector pGT0TMpf
Project baygenomics

Sequence tag KST059
Sequence
ACGTTNNCCCGATGTGCACAATGGCGTATATCCAGGATGCTGAGCACCCGGCTCACGCTGCATCTCTGCTNAGTCTCTAG
GTGCTTCCAGCATGGCTTCTGGTCAGATTGAAGTCTNCATGGATCGAAGGCTCATGCAGGATGATAACCGTGGCCTTGGG
CAAGGCGTCCATGACAATAAGATTACAGCTAATTTGTTTCGAATCCTCCTCGAGAAGAGAAGCGCTGTGAACATGGAAGA
AGAAAAGAAGAGCCCNTGTCNAATACCCTTCCCTCCNNNGCCCACATGACTTCGTCCTTCCTCAACCATCCCTTTCTCCC
CATGGTACTAAATGGCCAGCTCCCCTCCCCTGCCTTTGAGCTGCTGAGTGAATTTCCTCTGCTGCAGTCCTCTCTACCTT
GTGATATCCATCTGGTCAACCTGCGGACAATACAATCAAA
Sequence Type mRNA
Unitrap ID UNI10306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65083107..65090222 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024085 (Man2a1) NM_008549 mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]

 
Come back to gene ENSMUSG00000024085


For any suggestions or comments, please send an email to unitrap@crg.es