Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E080C01
Clone ID E080C01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE080C01
Sequence
TTGTTTTTGTTTTTTAGTGAAGTTTTTTCATCAACTGTTGGTATAATTCTAAAGCACTCCAAATTTAAATTTTTCTTATT
TAGAAATGACA
Sequence Type genomic DNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101410786..101410876 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es