Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E080A06
Clone ID E080A06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE080A06
Sequence
GTCCTGGTCCCTCAAGCAGAGAAGAGCCAGGACATAAAGGTGATCTCATCTGGAAATGGACACCCTTTGCTTTGAATTAG
GAAGCCATAACTACCAAGAAAATGGAGCCATGTTCTCTGTGAACTACAACTCCCAGTGGTCTCCACGAAGAGCGCGAACG
AACTTACGCAGCAAATTAGCATGTCTTTCGCCTTCAATTCCCGACATGCCTTTCCCAGTCTGGATTTCCTACGGTTGGCT
AAATTTCCTGTTTCCTGTCCATTTTGTAGCAACGGACTAGAGTTCCCAGACGCTGGGAGGCTCGCTTCGGTTTTGTTTTG
TTTTGAGCCTTCCTTTCCGCAATTTGACTACATCTCCCAAAAATCCGGTGGGTGGGGACTGCGGACGTAGAGAACGCACG
TGGAAAGAAAGTTGCGGGGAGGTGAGGCTACTCAGCGACGGGGAAGGTCGGAAGGTGGATAAGCGAAGGGACTTCTTTTC
CTAGTTTTAAACTGAGCCTTGGGCTCCTCTTTTGCTAGGACGTTGGAGCTATCCGCATATCGGGGTGAGTCTGACGAGGG
AATTACTTGAGGCGGTGACCTGAGGACTTGTACT
Sequence Type genomic DNA
Unitrap ID UNI29762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87723207..87723800 594
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019710 (Mrpl24) NM_026591 mitochondrial ribosomal protein L24 Gene [Source:MGI (curated);Acc:Mrpl24-002]


SPLK-Sequence tag 3SE080A06
Sequence
ACTGAGAAGAAAGCCAGCCCCACCACNNNAAGTGACACTAGCTAGCATCTAGGTTGTGTAGGGAACCAAAGGGAAAGATG
GAGTGGGGGCCTGTCCGGGGCCTAAAGGAGTTTTTAAAACAAACAAGCAAGA
Sequence Type genomic DNA
Unitrap ID UNI29762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87723798..87723928 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019710 (Mrpl24) NM_026591 mitochondrial ribosomal protein L24 Gene [Source:MGI (curated);Acc:Mrpl24-002]

 
Come back to gene ENSMUSG00000019710


For any suggestions or comments, please send an email to unitrap@crg.es