Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E079E09
Clone ID E079E09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE079E09
Sequence
GATCTCTGCTGGCTCTAGGAGCTTCTAACTGTCACATCGACACCCTGACTGCCCCCTAAGGCAACTCCTGTGGCAGTGCC
TTTCACATGCTGAGCTCCTACAACTCTACAGCTGCTAGT
Sequence Type genomic DNA
Unitrap ID UNI15349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29507870..29507988 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es