Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E079C12
Clone ID E079C12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE079C12
Sequence
CTCATGAAGGGGAAAAAATATCTAAAAATGGCATGATCTTGGGTTTGCAGGGCCTACAGGCTCTGAATCTTCTCAAAGCC
CTGGTAGTAATAGCACATGTTATCTCTTTGCGCTCAATAATTTATTTATGTTTTGGAAGGGGGGGGTCTTCACTTCGTCT
TAAATGCCTGCTAAATCAGCGTTTCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE079C12
Sequence
CATGAAGTCAGCTCTGTACATCNNACTTGTGTTTTTTAAGTGTCTCCTTTCTGCCTAAAAGCAGATTGCGACGGTCACAA
ACTACATATAAATCAAGTATGGCTTTTAAATGAGTAGTTTCTCCCTCAAATCTAGCAATTACTTCATGTAGGCGCTCCTT
CAGAACCAGCAATTATTCCATAGTACTTTTCTAGAAAGTGTAATTTGGTTGTTACCTCAAATTAGGTTATTGCCGTCTAA
CATTCGGATGCAGTAACCATCCTTATTTTACTAGAGTACATTTTGAGAGAGTATTGGTTGAATTTAAGGACAGAGTGTAC
ATTAGAACGTATAGGTTCCCTGTGGTTGTCTTTTGTTGCCTTTTTTCCCCCCAAGACA
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51029633..51030010 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es