Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E078G07
Clone ID E078G07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE078G07
Sequence
TCGGGCCTCAAGCTCAGAAACGGAACAGAATCCGCATCGACCCTCCTCGGCAGCCTCCTGATGCCGAGATGAGAGGCGTG
AGCCGTGCCACAAATTCACTGTGTTCCCTCAGTGAAATTCTGTCAACTTCTACATCCTGTGTGAAAATCTAAGTCAGCGA
CTCACATCAGAATCA
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64020196..64020369 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es